Found some interesting work on the creation of pseudoviruses using HIV and SARS coronavirus

The big gripe that molecular geneticists had about the supposed 4 inserts from the HIV geneome into the Wuhan virus genome was that the 4 nucleotide sequences were discontinuous

Meaning that the 4 chains of amino acids were spread out in the virus genome

They were about this long-----> taggcta

Each supposed " insert " was spread out from the others, and this fact of separation was used by the scientists that claimed that this is proof that the science done by the Indian scientists was bad, because when you normally look for evidence of transgenes ( inserted genetic material ), you look for the evidence of a pShuttle, which in turn will be attached to a large chain of amino acids

( A pShuttle is a recombinant plasmid ( An engineered tool used for gene insertions, " p " means " plasmid " )
Normally, in order to really be considered evidence of a gene insertion, and since there are practically countless plasmids created in endless labs, you have to look for the genes that were inserted WITH the pShuttle

So you look for a long chain like this:

gatgctagatgtttaagaagcctagttccagattaccagtgatgctagatgtttaagaagc​ctagttccagattaccagtgatgctagatgtttaagaagcctagttccagattaccagtga​tgctagatgtttaagaagcctagttccagattaccagtgatgctagatgtttaagaagcct​agttccagattaccagtgatgctagatgtttaagaagcctagttccagattaccagt

Then the pShuttle chains would normally be here:

gatgctagatgtttaagaagcctagttccagattaccagtgatgctagatgtttaag​aagcctagttccagattaccagtgatgctagatgtttaagaagcctagttccagattacca​gtgatgctagatgtttaagaagcctagttccagattaccagtgatgctagatgtttaagaa​gcctagttccagattaccagtgatgctagatgtttaagaagcctagttccagattacca​gt

Those red chains bind the insert into the rest of the genome ( From one organism into another )





So here's the problem with the claiming that the indian scientists were wrong

When the actual S-protein of the Wuhan virus folds, it just so happens that the 4 " HIV inserts " happen to line up exactly at the spike tip of the S-protein that the Virus uses to bind to ACE2 which is then used to gain entry into the cells


This combining of HIV and Coronavirus genomes is discussed in this following paper identifying novel ACE2 inhibitors ( Things that block the virus from using the body's own ACE2 peptide to gain entry to cells )


[link to www.ncbi.nlm.nih.gov (secure)]