As far as I know NOBODY ANYWHERE has done this matching.
It's new. It could be profound. It draws a link between a 2006 publication and what's supposed to be circulating now.
The match itself is 26 consecutive bases long.
The chance of that being random is cosmically low: 4-to-the-power-26 (4x4x4xx4x4x4x4x4x4x4x4x4x...)
If it is not a known CoV sequence, it could be a smoking gun.Details:
========
I am matching between a (
2006) paper [
link to www.researchgate.net (secure)] naming an insert from a virus called "SARS-CoV-2", Supplementary Material [
link to academic.oup.com (secure)] file: "clinchem.2006.069971-1.doc"
and
The published genome (2020) of SARS-Cov-2 (Wuhan-Hu-1) from Genbank: [
link to www.ncbi.nlm.nih.gov (secure)]
I ran some basic analysis on this, systematically checking for long matches.
The longest I found was TWENTY SIX nucleotides in a row!
So, here is the 2006 sequence they call SARS-CoV-2 insert, 190 nucleotides long:
atgaattaccaagtcaatggttaccctaatatgtttatcacccgcgaagaagctattcgtcacgttcgtgcgtggattggctttgatgtagagggctgtcatgcaactagagat
gctgtgggtactaacctacctctccagctaggattttctacaggtgttaacttagtagc
tgtaccgactggttatg
I have highlighted the longest match I found (atgtttatcacccgcgaagaagctat).That sequence is found in the 2020 Genbank submission for SARS-CoV-2 (Wuhan-Hu-1) here: [
link to www.ncbi.nlm.nih.gov (secure)]
at position 18253:
(snip)
18241 ggttacccta ac
atgtttat cacccgcgaa gaagctataa gacatgtacg tgcatggatt
(snip)
---------------------------
Aside: Quote from 2006 paper:
"we tried to directly package a 1200-nucleotide–long foreign RNA sequence containing gene fragments of hepatitis C virus (HCV), HIV-1, severe acute respiratory syndrome coronavirus 1 (SARS-CoV1), and SARS-CoV2 into the original armored RNA production vector..."---------------------------
Now, if anyone knows whether
atgtttatcacccgcgaagaagctat is a common sequence for CoV's, please let me know!!??