AMERICAN BIOWARFARE PATHOGEN SARS COV-2, CREATED AT FORT DETRICK, MARYLAND NOW WREAKING HAVOC GLOBALLY

IT’s time we face up to our own demons.....

First off I have not nor will I receive the covid vaccine.

With that said my wife and I have both had "covid" twice now. First last January and now. I don't know what covid is, I personally think it's a Flu and most likely engineered. But whatever. The point of this post is that it is and always has been treatable.

So last January when we first got it we had severe headaches, body aches, sore throat, fever (101) and mild dry cough.
I tried Tylenol, didn't help, so then I tried advil, didn't help then I tried asprin didn't help. Each with about 4 to 6 hours in-between doses.

Then! I tried 1 500mg Tylenol, 1 advil, and 1 asprin. All taken at the same time. Within an hour headache body aches and fever just about completely gone. 6 hours later all came back repeated the dose and gone again. All that remained was the sore throat running nose and cough.

3 days after my infection started, my wife's started. She was miserable. I got her on the same dose I was taking and within an hour she was feeling great!

So we found that 1 Tylenol, 1 advil, and 1 asprin will knock out the pains and fever.

Now this last infection I wanted to deal with the sinus/lung part of it. So I did some research and came up with a solution.

I thought that if what was killing people was an over reaction of the immune system then if I could suppress it then I might have the answer. A little more research and I found that Antihistamines could do what I wanted. So I spoke with a pharmacist about what I was looking for.
She was very helpful!

So after being on the above cocktail, before bed I took a dose of children's benadryl. Slept very good with no need of pain relievers. And no fever. Then at 6am I started zyrtec 10mg.
That day I had no symptoms and no need at all for pain relief. Sore throat was getting better.

For the second day I took 5mg of zyrtec only. All symptoms returned! So back to benadryl for the night and zyrtec full dose 6am.

All symptoms gone all day.

By now my wife is also ill again so I start her on the same. And just like me all symptoms gone.
Sore throat gone, cough gone, fever gone, headache gone, body aches gone.

Finally today I ran out of zyrtec. And I had to go to work. So I skip the pharmacy and head to work. Symptoms return. All of them. Much milder (body is fighting it off) but headache is back, cough is back etc. So I have to go back to the tylenol,advil,asprin cocktail until I can get some zyrtec.

My thinking was that zyrtec would help. I didn't realize that it would bring the symptoms down to nothing like it did. It is extremely effective! Not all Antihistamines work the same. It is the method of action that is Key here. I do not believe that Claritin will be as effective. Due to different method of actions.

Benadryl is brutal in terms of next Dat hangover/weird feeling all day. I don't like it. But the pharmacist recommended it as a Kickstart.

Also zyrtec says it last 24hours. Not so.
It takes about an hour or 2 to get the full effect and then it lasts about 20 to 22hrs from the time you swallow the pill.

Anyway I didn't want to keep this to myself. So spread the word and keep people out of the hospital/murder hotels.

Try it and if for some reason it doesn't work for you then please post a reply.

Good luck!

Do not fear

OTC Covid treatment available



Covid 19 very effective OTC treatment.



[link to godlike.com (secure)]

(December 12, 1980) The Bayh–Dole Act
Sponsored by two senators, Birch Bayh(Democrat) of Indiana and Bob Dole(Republican) of Kansas the Act was adopted in 1980.
A key change made by Bayh–Dole was in the procedures by which federal contractors(global pharma companies) that acquired ownership of inventions
made with federal funding(taxpayers money) could retain that ownership. Before the Bayh–Dole Act, the Federal Procurement Regulation
required the use of a patent rights clause that in some cases required federal contractors or their inventors to assign
inventions made under contract to the federal government unless the funding agency determined that the public interest
was better served by allowing the contractor or inventor to retain principal or exclusive rights.
[link to en.wikipedia.org (secure)]

(1981) The Eyes of Darkness - a thriller novel written by American writer Dean Koontz.
The novel mentions a bioweapon that in earlier editions is called "Gorki-400"
and in later editions was called "Wuhan-400".
Gorki is a Russian city and named as the origin of that bioweapon in the 1981 edition.
Due to the end of the Cold War, the origin of the bioweapon was changed to the Chinese city of Wuhan
and the bioweapon was renamed "Wuhan-400" for the 2008 edition onward.
[link to en.wikipedia.org (secure)]

(March 8, 1992) U.S. STRATEGY PLAN CALLS FOR INSURING NO RIVALS DEVELOP
[link to www.nytimes.com (secure)]

(February 1995) right-wing extremist, Larry Wayne Harris from Ohio,
ordered three vials of plague pathogen from the American Type Culture Collection,
one of the largest collections of microorganisms in the world. In the same year,
the extreme right-winger Timothy McVeigh carried out a bomb attack against a government building in Oklahoma City,
killing more than 150 people.

(September 2000) PNAC(Project for the New American Century) released "Rebuilding America's Defenses"
a report that promotes "the belief that America should seek to preserve and extend its position of global leadership by maintaining the preeminence of U.S. military forces." (Introduction part IV)
The report also states, "advanced forms of biological warfare that can “target” specific genotypes may transform biological warfare from the realm of terror to a politically useful tool."(page 60)
"Further, the process of transformation,even if it brings revolutionary change, is likely to be a long one, absent some catastrophic and catalyzing event – like a new Pearl Harbor."(page 51)
[link to en.wikipedia.org (secure)]
[link to wikispooks.com (secure)]

(September 11, 2001) Dancing Israelis
A New York resident referred to by ABC only as "Maria" reports that on the morning of 9/11,
a neighbor called her shortly after the first plane hit the World Trade Center.
She watched the destruction unfolding in lower Manhattan through binoculars
and three young men kneeling on the roof of a white 2000 Chevrolet van
in the parking lot of her apartment building caught her attention since "they seemed to be taking a movie".
Particularly suspicious she found the expressions on the men's faces. "They were like happy, you know...
[link to wikispooks.com (secure)]

(September 18, 2001) One week afer the 9/11 attack
on the World Trade Center towers in New York City, letters containing
anthrax bacteria were mailed to several news media offices and two
U.S. Senators, ultimately killing five people and infecting 17 others.
[link to www.researchgate.net (secure)]

During their investigation, the FBI concluded that Bruce Edward Ivins,
a microbiologist for the United States Army, had mailed the deadly letters.
The FBI obtained some of the anthrax spores and analyzed them.
After analyzing the spores, the FBI traced the spores to a military
lab located at Fort Detrick, Maryland.
[link to en.wikipedia.org (secure)]
[link to en.wikipedia.org (secure)]

(2005) An effort to recreate the 1918 flu strain
(a subtype of avian strain H1N1) was a collaboration among the Armed Forces Institute of Pathology,
the USDA ARS Southeast Poultry Research Laboratory, and Mount Sinai School of Medicine in New York City.
The effort resulted in the announcement (on 5 October 2005) that the group had successfully determined the virus's genetic sequence,
using historic tissue samples recovered by pathologist Johan Hultin
from a female flu victim buried in the Alaskan permafrost and samples preserved from American soldiers.

(December 16, 2008) Synthetic recombinant bat SARS-like coronavirus is infectious in cultured cells and in mice
Here, we report the design, synthesis, and recovery of the largest synthetic replicating life form, a 29.7-kb
bat severe acute respiratory syndrome (SARS)-like coronavirus (Bat-SCoV), a likely progenitor to the SARS-CoV epidemic.
To test a possible route of emergence from the noncultivable Bat-SCoV to human SARS-CoV, we designed
a consensus Bat-SCoV genome and replaced the Bat-SCoV Spike receptor-binding domain (RBD) with the SARS-CoV RBD(Bat-SRBD).
Bat-SRBD was infectious in cell culture and in mice and was efficiently neutralized by antibodies specific for both bat and human CoV Spike proteins.
[link to www.pnas.org (secure)]

"It can be very hard to study where a virus originally came from," said Mark Denison. "If you start from where you think the virus was,
and let the virus tell you where it's going, then you learn a tremendous amount about viral evolution and movement."
Denison's team used the genetic sequence of bat SARS to build the virus. Bat SARS doesn't normally infect people,
but the researchers added a critical tweak: a gene present only in the human version of the virus. The new version
flourished in human cell cultures, suggesting that a mutation in the gene, known as
Bat-SRBD, was responsible for SARS' lethal spread.
[link to www.wired.com (secure)]

(December 20, 2011) Seeing Terror Risk, U.S. Asks Journals to Cut Flu Study Facts
In the experiments, conducted in the United States(Yoshihiro Kawaoka) and the Netherlands(Ron Fouchier),
scientists created a highly transmissible form of a deadly flu virus
that does not normally spread from person to person.
[link to www.nytimes.com (secure)]

(January 20, 2012) Fears of mutant virus escape halt bird flu study
Researchers studying a potentially more lethal, airborne version of the bird flu virus have suspended their studies
because of concerns the mutant virus they have created could be used as a devastating form of bioterrorism or accidentally escape the lab.

Nature reported last month that both experiments on mutant viruses were carried out in labs rated “biosafety level 3 (BSL-3) enhanced,
” which “require scientists to shower and change clothes when leaving the lab,
and include other safety features such as negative air pressure and passing
exhaust air through high-efficiency particulate air filters.”

But some virologists argue that the more stringent BSL-4 precautions are needed.
BSL-4, which is required for research on, among other microbes, the Ebola virus,
includes full-body positive air-pressure suits like astronauts use.
In the past, the SARS (severe acute respiratory syndrome) virus has escaped from BSL-3, and possibly BSL-4, labs.
[link to Spam (secure)]

(May 2, 2012) Mutant-flu paper published (by Yoshihiro Kawaoka at the University of Wisconsin–Madison)
Controversial study shows how dangerous forms of avian influenza could evolve in the wild.
[link to www.nature.com (secure)]

(June 21, 2012) Second mutant-flu paper published (by Ron Fouchier from the Erasmus Medical Centre in Rotterdam)
Just five mutations allow H5N1 to spread between ferrets.
[link to www.nature.com (secure)]

(January 23, 2013) H5N1 Researchers Announce End of Research Moratorium
[link to www.sciencemag.org (secure)]

(April 15, 2014) Vials of deadly SARS virus 'go missing' in France
[link to www.fuck (secure)] off.co.uk/news/worldnews/europe/france/10768179/Vials-of-dead​ly-SARS-virus-go-missing-in-France.html
[link to www.businessinsider.com.au (secure)]

(June 2014) Yoshihiro Kawaoka of the University of Wisconsin-Madison has genetically manipulated the 2009 strain of pandemic flu
in order for it to “escape” the control of the immune system’s neutralising antibodies.
Lord May said he suspected the NIH supported the work because officials there were "incompetent"
and believed the justifications that scientists told them. "This is work that shouldn't be done. It's as simple as that," he said.

Institute for Influenza Virus Research in Madison which was built specifically to house Professor Kawaoka’s laboratory,
which has a level-3-agriculture category of biosafety: one below the top safety level for the most dangerous pathogens, such as Ebola virus.
However, this study was done at the lower level-2 biosafety.
[link to www.businessinsider.com (secure)]
[link to www.theguardian.com (secure)]

Marc Lipsitch, Professor of Epidemiology at the Harvard School of Public Health, said:
‘I am worried that this signals a growing trend to make “transmissible” novel viruses willy-nilly.
This is a risky activity, even in the safest labs.
‘Scientists should not take such risks without strong evidence that the work could save lives, which this paper does not provide.’

Other scientists used stronger language.
‘If society understood what was going on,’ thundered Professor Simon Wain-Hobson,
of the Virology Department at the Pasteur Institute in Paris, ‘they would say “What the F are you doing?”
[link to www.dailymail.co.uk (secure)]

(October 17, 2014) U.S. halts funding for new risky virus studies, calls for voluntary moratorium
[link to www.sciencemag.org (secure)]
[link to www.the-scientist.com (secure)]

(November 16, 2015) Ralph S. Baric, an infectious-disease researcher at the University of North Carolina at Chapel Hill,
last week (November 9) published a study on his team’s efforts to engineer a virus with the surface protein of the SHC014 coronavirus,
found in horseshoe bats in China, and the backbone of one that causes human-like severe acute respiratory syndrome (SARS) in mice.
The hybrid virus could infect human airway cells and caused disease in mice, according to the team’s results, which were published in Nature Medicine.

Baric’s study on the SHC014-chimeric coronavirus began before the (2014) moratorium was announced,
and the NIH allowed it to proceed during a review process, which eventually led to the conclusion
that the work did not fall under the new restrictions, Baric told Nature.
But some researchers, like Wain-Hobson, disagree with that decision.
[link to www.the-scientist.com (secure)]

“I don’t think it’s wise or appropriate for us to create large risks that don’t already exist,” says David Relman,
a microbiologist at Stanford University. He thinks the government was right to include SARS and MERS in this moratorium,
because they are so close to being pandemic viruses. “I’m quite delighted that great scientists like Ralph Baric are working on SARS
and doing the work they are doing,” says Relman. “But there still are specific experiments that I think should cause everyone pause
and potentially cause concern if conducted.” For SARS and MERS, he says, “the one thing that I would feel most concerned about doing
is to give them that one missing trait, their means of transmitting easily between humans.”

Baric says that kind of experiment is not happening in his lab. He’s not trying to change the way SARS or MERS gets transmitted.
In fact, he doesn’t know of any lab trying to do that.
Still, his group has recently been tweaking the genes of the MERS virus. So is he making it more dangerous?
“If you’re a mouse, the answer is probably yes, or at least I was trying to,” says Baric.
[link to www.npr.org (secure)]

(May 28, 2015) Since 2003, the CDC has referred 79 labs
for potential enforcement actions by the U.S. Department of Health and Human Services'
Office of Inspector General. It has levied fines against 19 of them totaling more than $2.4 million, the CDC said in response to questions.
Some are repeat offenders. Five labs have had "multiple referrals" for enforcement actions, the CDC said.
Two labs have been kicked out of the program, and five labs have been suspended from doing any select agent research, the agency said.
Which labs repeatedly failed to address safety problems? The CDC won't name names — not even for the two labs kicked out of the select agent program.
The CDC and its regulatory partners at the USDA say the 2002 bioterrorism law requires keeping this information secret.
[link to www.usatoday.com (secure)]

(October 9, 2015) Antiviral compound effectively treated Ebola in monkeys (GS-5374 - later named Remdesivir)
A clinical trial of the compound, GS-5374, is currently being conducted by the company Gilead Sciences,
which worked with the United States Army Medical Research Institute of Infectious Diseases, or USAMRIID, to develop it.
[link to www.upi.com (secure)]

(Jannuary 4, 2017) CDC scientists apparently lost a box of deadly and highly-regulated influenza specimens
and experienced multiple potential exposures involving viruses and bacteria,
according to heavily-redacted laboratory incident reports obtained by USA TODAY
[link to www.usatoday.com (secure)]

(June 28, 2017) New drug holds potential to defeat coronaviruses
Scientists at the UNC Gillings School of Global Public Health have confirmed that an experimental antiviral treatment
prevents the development of SARS coronavirus (SARS-CoV) disease in mice. The drug, GS-5734(Remdesivir), also inhibits MERS-CoV
and multiple other coronaviruses (CoV), suggesting that the treatment may inhibit all CoV.

To date, there are no approved therapies to treat any kind of CoV infection.
GS-5734(Remdesivir) is being developed through a unique public-private partnership between
investigators at the University of North Carolina, Vanderbilt University’s School of Medicine and Gilead Sciences, Inc.
[link to sph.unc.edu (secure)]

(July 10, 2017) The Pentagon Ponders the Threat of Synthetic Bioweapons
They point to 2014, when the federal government halted 18 studies on so-called “gain of function”
research that tinkered with viruses like MERS, SARS, and the flu to make them more likely to transmit in humans.
The White House is taking another look at that moratorium to determine whether it still makes sense.
Many scientists hope the ban is lifted—they argue understanding how viruses mutate is critical to stop them.
[link to www.wired.com (secure)]

(August 31, 2017) Gillings School researchers receive $6M+ grant to fight infectious diseases
The partnership grant awarded to Baric and Sheahan establishes a collaboration between the Gillings School and
Gilead Sciences Inc., Vanderbilt University Medical Center and the University of Texas Medical Branch.
The collaboration builds upon an earlier partnership between the Gillings School and Gilead Sciences Inc.,
and will focus specifically on GS-5734(Remdesivir), an experimental antiviral treatment.
[link to sph.unc.edu (secure)]

(December 19, 2017) The US government is lifting a ban on engineering deadly viruses to make them more dangerous
[link to www.sciencemag.org (secure)]
[link to www.businessinsider.com (secure)]
[link to grants.nih.gov (secure)]

(January 24, 2018) Woman Working at NIH Killed in Parking Lot Crash
[link to www.nbcwashington.com (secure)]

(February 12, 2018) Timothy Jerrell Cunningham (C.D.C. Employee) was last seen leaving work
(December 21, 1982 - 2018) was a Harvard-educated (African American) doctor with the US Center for Disease Control and Prevention. As an epidemiologist, he was a team leader in the US Public Health Service Commissioned Corps and was named in 2017 as part of the Atlanta Business Chronicle's 40 Under 40 list. He also was the co-author of 28 publications on topics about sleep deprivation, pulmonary disease and more. Cunningham graduated from Morehouse and earned his S.M and ScD. from Harvard T.H. Chan School of Public Health
[link to en.wikipedia.org (secure)]

The doctor, who went to Harvard as well as Morehouse, had worked on a study about the disparities in death rates among Blacks that was published last May.
The study was connected to a 1996 ban by the NRA against the CDC examining gun violence as a crisis, according to social media users who pointed out that
Cunningham’s bizarre disappearance happened after this controversial publication.

In addition, Internet rumors about Cunningham being a whistle-blower who had cautioned the public about the flu shot
being responsible for this year’s deadly flu season have been touted as a possible reason for his disappearance,
a claim that his father, Terrell Cunningham disputed as false to CNN.
[link to newsone.com (secure)]

(May 10, 2018) Top White House official in charge of pandemic response exits abruptly
The top White House official responsible for leading the U.S. response in the event
of a deadly pandemic has left the administration, and the global health security
team he oversaw has been disbanded under a reorganization by national security adviser John Bolton.
White House homeland security adviser Tom Bossert, who had called for a comprehensive biodefense strategy against pandemics and biological attacks,
is out completely.
[link to www.washingtonpost.com (secure)]

(March 1, 2019) Studies of Deadly Flu Virus, Once Banned, Are Set to Resume
[link to www.nytimes.com (secure)]

(May 23, 2019) How did six migrant children die on the US border?
Six children have died since September while in US custody.
Just this week, US authorities said a 16-year-old Guatemalan migrant
had died on Monday and revealed that a 10-year-old girl from El Salvador died back in September.

Previously no migrant children had died in federal custody since 2010, according to US government officials.
[link to www.bbc.com (secure)]

(June 11, 2019) Tweets from Turkish psychic-insider close to authorities
"The U.S. sent an aircraft of biological weapons to China.
Epidemics may begin in China soon.
They should not forget that if there is a Turk on earth, there is hope."
[link to twitter.com (secure)]

(July 2019) Fort Detrick lab shut down after failed safety inspection; all research halted indefinitely
[link to Spam (secure)]

Premise:
Hon Lik (or Han Li) a Chinese native, born in Shenyang, China registered a patent for the modern e-cigarette design in 2003. The e-cigarette was first introduced to the Chinese domestic market in 2004., entered the European market and the US market in 2006 and 2007. In the UK, users have increased from 700,000 in 2012 to 2.6 million in 2015, and in 2015 around 10% of American adults were users. About 60% of UK users are smokers and about 40% are ex-smokers, while use among never-smokers in the UK is negligible.

(Jul 29, 2019) Eight Milwaukee-area teens hospitalized with severe lung damage that may have been caused by vaping
The teens were brought to Children's Hospital of Wisconsin with extreme cough, significant shortness of breath and fatigue.
Some had lost weight from vomiting and diarrhea, hospital officials said Thursday.
[link to eu.jsonline.com (secure)]

(August 17, 2019) Mystery lung illness linked to vaping. Health officials investigating nearly 100 possible cases.
In the past month, the teenagers presented symptoms that appeared manageable and consistent with viral-type infections or bacterial pneumonia —
shortness of breath, coughing, fever and abdominal discomfort, Chapman said. But they continued to deteriorate despite appropriate treatment,
including with antibiotics and oxygen support. Some suffered respiratory failure and had to be put on ventilators, she said.
[link to www.washingtonpost.com (secure)]

(September 12, 2019) Europe’s missing ‘vaping sickness’
Europe does not appear to be experiencing an outbreak of the “vaping sickness” gripping the U.S.
It’s not clear anyone would know if it was. U.S. President Donald Trump on Wednesday moved to finalize a ban
on flavored e-cigarettes in light of the country’s outbreak of a vaping-related illness that’s made 450 people sick and resulted in at least six deaths.

“We have not seen anything like what we’ve seen in the U.S. recently in Europe, to my knowledge as a scientist,
and I’m pretty aware of the field,” said Constantine Vardavas, the European Respiratory Society’s scientific relations director with the EU.
[link to www.politico.eu (secure)]

(September 27, 2019) Flu season threatens to complicate diagnoses of vaping-related illness
The issue, experts say, is that flu and other respiratory viruses can, in many ways, look strikingly similar
to a case of vaping-related illness: Symptoms include shortness of breath, night sweats, low oxygen levels,
and hazy spots on a lung X-ray.

“It’s going to be difficult to tease apart a bad flu case and a vaping case,” said Dr. Sean Callahan,
a University of Utah Health pulmonologist who has treated several cases of vaping-related illness.
The CDC, when asked, didn’t respond directly to the question of whether its definition might need to be revised.
[link to www.statnews.com (secure)]

(September 2019) Trump administration cut pandemic early warning program
The Trump administration decided to end a $200m early warning program designed to alert
it to potential pandemics just three months before it is believed Covid-19 began infecting people in China.

The project, called Predict, had been run by the US Agency for International Development since 2009.
It had identified more than 160 different coronaviruses that had the potential to develop into pandemics,
including a virus that is considered the closest known relative to Covid-19.
[link to www.theguardian.com (secure)]

(October 4, 2019) US vaping illness deaths rise to 18 with 1,000 cases reported
At least 18 deaths and more than 1,000 cases of a mysterious lung illness
have been linked with vaping by US health authorities.
Doctors have been unable to establish what is causing the illness,
whose symptoms include chest pain, fatigue and shortness of breath.
[link to www.bbc.com (secure)]

(October 3, 2019) Conservative groups urge Trump to back off ban on flavored vaping products
The Food and Drug Administration (FDA) is expected to issued guidance on the prohibition soon,
arguing the flavors are appealing to children and leading to rising youth vaping rates.
But conservatives say the ban, which doesn't apply to tobacco flavors,
would hurt small vape businesses and adults trying to quit cigarettes.
[link to thehill.com (secure)]

(October 25, 2019) Scientists Were Hunting for the Next Ebola. Now the U.S. Has Cut Off Their Funding
In a move that worries many public health experts, the federal government is quietly shutting down a surveillance program
for dangerous animal viruses that someday may infect humans.
[link to www.nytimes.com (secure)]

Five foreign athletes from military world games in Wuhan infected with malaria, not COVID-19 in October 2019: hospital head
[link to www.globaltimes.cn (secure)]

(November 15, 2019) CDC begin hiring Quarantine Public Health Advisors
Location: Anchorage, Alaska, Los Angeles, California, San Diego, California, San Francisco, California,
Miami, Florida, Atlanta, Georgia, Honolulu, Hawaii, Chicago, Illinois, Boston, Massachusetts, Detroit, Michigan,
Minneapolis, Minnesota, Newark, New Jersey, New York, New York, Philadelphia, Pennsylvania, Dallas, Texas, El Paso, Texas, Houston, Texas, Seattle, Washington, San Juan
[link to jobs.cdc.gov (secure)]

(November 17, 2019) U.S. and South Korea postpone military drills in bid to save North Korea dialogue
The United States and South Korea have postponed joint air drills that were scheduled this month in an attempt
to save a faltering dialogue process with North Korea, officials announced Sunday.
[link to www.washingtonpost.com (secure)]

(November 23, 2019) CDC Approves Partial Resumption of USAMRIID Select Agent Research
[link to globalbiodefense.com (secure)]

(December 19, 2019) Quantum Dots Deliver Vaccines and Invisibly Encode Vaccination History in Skin
Researchers headed by a team at the Massachusetts Institute of Technology (MIT) have created a microneedle platform
using fluorescent microparticles called quantum dots (QD), which can deliver vaccines and at the same time invisibly encode vaccination
history directly in the skin. The quantum dots are composed of nanocrystals, which emit near-infrared (NIR) light that can be detected
by a specially equipped smartphone.
[link to www.genengnews.com (secure)]

Exclusive: U.S. Axed CDC Expert Job in China Months Before Virus Outbreak
[link to www.nytimes.com (secure)]

(April 7, 2020) The coronavirus is infecting and killing black Americans at an alarmingly high rate
In Milwaukee County, home to Wisconsin’s largest city, African Americans account for about 70 percent of the dead
but just 26 percent of the population. The disparity is similar in Louisiana, where 70 percent of the people
who have died were black, although African Americans make up just 32 percent of the state’s population.
[link to www.washingtonpost.com (secure)]

(April 9, 2020) Intelligence report warned of coronavirus crisis as early as November: Sources
"Analysts concluded it could be a cataclysmic event," a source says.
[link to abcnews.go.com (secure)]

(April 10, 2020) RdRp, also named nsp12 is the central component of coronaviral replication/transcription machinery
The RNA-dependent RNA polymerase (RdRp, also named nsp12) is the central component of coronaviral replication/transcription machinery
and appears to be a primary target for the antiviral drug, remdesivir.
[link to science.sciencemag.org (secure)]

(April 10, 2020) Coronavirus is disproportionately killing African Americans
Earlier this week, officials in Chicago, Illinois were among the first to release a racial breakdown
of the city's 6,100 cases. More than half were African American, despite only the group only accounting
for 30 percent of the city's 2.7 million residents. Seven in 10 patients who died from COVID-19
in the city were African American, officials said.
[link to www.aljazeera.com (secure)]
[link to abcnews.go.com (secure)]

(April 17, 2020) Coronavirus Drug Results Send Gilead Sciences Stock Flying; JPMorgan Weighs In
New data from a University of Chicago Hospital Phase 3 clinical trial of Gilead's remdesivir antiviral drug, also known as "GS-5734"
shows promising results for the drug's efficacy in treating the novel coronavirus. And no sooner had the data come out, than Gilead's
stock price began marching higher again, rising 12% in pre-market trading on Friday.
[link to www.nasdaq.com (secure)]

(April 18, 2020) New CDC data shows Covid-19 is affecting African Americans at exceptionally high rates
The Centers for Disease Control and Prevention (CDC) released new, preliminary nationwide data on Friday,
that revealed 30 percent of Covid-19 patients are African American, even though African Americans make up around 13 percent of the population of the United States.
[link to www.vox.com (secure)]

As far as I know NOBODY ANYWHERE has done this matching.
It's new. It could be profound. It draws a link between a 2006 publication and what's supposed to be circulating now.

The match itself is 26 consecutive bases long.
The chance of that being random is cosmically low: 4-to-the-power-26 (4x4x4xx4x4x4x4x4x4x4x4x4x...)

If it is not a known CoV sequence, it could be a smoking gun.


Details:
========
I am matching between a (2006) paper [link to www.researchgate.net (secure)] naming an insert from a virus called "SARS-CoV-2", Supplementary Material [link to academic.oup.com (secure)] file: "clinchem.2006.069971-1.doc"

and

The published genome (2020) of SARS-Cov-2 (Wuhan-Hu-1) from Genbank: [link to www.ncbi.nlm.nih.gov (secure)]

I ran some basic analysis on this, systematically checking for long matches.
The longest I found was TWENTY SIX nucleotides in a row!

So, here is the 2006 sequence they call SARS-CoV-2 insert, 190 nucleotides long:
atgaattaccaagtcaatggttaccctaatatgtttatcacccgcgaagaagctat​
tcgtcacgttcgtgcgtggattggctttgatgtagagggctgtcatgcaactagagat
gctgtgggtactaacctacctctccagctaggattttctacaggtgttaacttagtagc
tgtaccgactggttatg

I have highlighted the longest match I found (atgtttatcacccgcgaagaagctat).

That sequence is found in the 2020 Genbank submission for SARS-CoV-2 (Wuhan-Hu-1) here: [link to www.ncbi.nlm.nih.gov (secure)]
at position 18253:
(snip)
18241 ggttacccta acatgtttat cacccgcgaa gaagctataa gacatgtacg tgcatggatt
(snip)


---------------------------

Aside: Quote from 2006 paper:
"we tried to directly package a 1200-nucleotide–long foreign RNA sequence containing gene fragments of hepatitis C virus (HCV), HIV-1, severe acute respiratory syndrome coronavirus 1 (SARS-CoV1), and SARS-CoV2 into the original armored RNA production vector..."

---------------------------

Now, if anyone knows whether atgtttatcacccgcgaagaagctat is a common sequence for CoV's, please let me know!!??