DO NOT FORGET THE US FOISTED THIS SARS COV-2 ON THE WORLD SETTING OFF THIS COVID-19 PANDEMIC | |
Anonymous Coward User ID: 86886479 United Kingdom 02/26/2024 05:44 PM Report Abusive Post Report Copyright Violation | I just found 26-nucleotide match between a 2006 paper naming 'SARS-CoV-2" and the current 2019 version. As far as I know NOBODY ANYWHERE has done this matching. Quoting: S-man It's new. It could be profound. It draws a link between a 2006 publication and what's supposed to be circulating now. The match itself is 26 consecutive bases long. The chance of that being random is cosmically low: 4-to-the-power-26 (4x4x4xx4x4x4x4x4x4x4x4x4x...) If it is not a known CoV sequence, it could be a smoking gun. Details: ======== I am matching between a (2006) paper [link to www.researchgate.net (secure)] naming an insert from a virus called "SARS-CoV-2", Supplementary Material [link to academic.oup.com (secure)] file: "clinchem.2006.069971-1.doc" and The published genome (2020) of SARS-Cov-2 (Wuhan-Hu-1) from Genbank: [link to www.ncbi.nlm.nih.gov (secure)] I ran some basic analysis on this, systematically checking for long matches. The longest I found was TWENTY SIX nucleotides in a row! So, here is the 2006 sequence they call SARS-CoV-2 insert, 190 nucleotides long: atgaattaccaagtcaatggttaccctaatatgtttatcacccgcgaagaagctat tcgtcacgttcgtgcgtggattggctttgatgtagagggctgtcatgcaactagagat gctgtgggtactaacctacctctccagctaggattttctacaggtgttaacttagtagc tgtaccgactggttatg I have highlighted the longest match I found (atgtttatcacccgcgaagaagctat). That sequence is found in the 2020 Genbank submission for SARS-CoV-2 (Wuhan-Hu-1) here: [link to www.ncbi.nlm.nih.gov (secure)] at position 18253: (snip) 18241 ggttacccta acatgtttat cacccgcgaa gaagctataa gacatgtacg tgcatggatt (snip) --------------------------- Aside: Quote from 2006 paper: "we tried to directly package a 1200-nucleotide–long foreign RNA sequence containing gene fragments of hepatitis C virus (HCV), HIV-1, severe acute respiratory syndrome coronavirus 1 (SARS-CoV1), and SARS-CoV2 into the original armored RNA production vector..." --------------------------- Now, if anyone knows whether atgtttatcacccgcgaagaagctat is a common sequence for CoV's, please let me know!!?? Thread: I just found 26-nucleotide match between a 2006 paper naming 'SARS-CoV-2" and the current 2019 version. |
Anonymous Coward User ID: 86888437 Germany 02/28/2024 03:49 PM Report Abusive Post Report Copyright Violation | Thread: Was Coronavirus a Biowarfare Attack Against China? Thread: AMERICAN BIOWARFARE PATHOGEN SARS COV-2, CREATED AT FORT DETRICK, MARYLAND NOW WREAKING HAVOC GLOBALLY Thread: US Publisher: What if COVID Outbreak Is Part of the Pentagon's Biowarfare Plan? Thread: US Publisher: What if COVID Outbreak Is Part of the Pentagon's Biowarfare Plan? Thread: U.S. Biowarfare Programs Have 13,000 Death Scientists Hard At Work Thread: DO NOT FORGET THE US FOISTED THIS SARS COV-2 ON THE WORLD SETTING OFF THIS COVID-19 PANDEMIC |
Anonymous Coward User ID: 86836325 United States 02/28/2024 07:22 PM Report Abusive Post Report Copyright Violation | The history of the Covid-19 pandemic started long before 2019. Quoting: Coastie Patriot If I were to put a start date on the series of events leading to Covid-19, I’d start in 2011 when the Dutch scientist Ron Fouchier and his team at Erasmus University acquired a highly pathogenic avian influenza, bred the virus to be more infectious in mammals, and then opted to publish his findings in a scientific journal with global reach. At many points in the series of events, Dr. Fouchier ( Close to FAUCI) had other options. I’m also a biologist, I’ve also thought of terrifying things one could make by a mix of genetic engineering and breeding, but unlike Dr. Fouchier I did not act on those horrific impulses, let alone share these ideas in the public domain. After breeding a potentially pandemic pathogen with ease, Dr. Fouchier had the option of reporting his findings to the Dutch defense and intelligence community in a non-public venue, raising their awareness of a threat without popularizing his handbook for bioterrorists worldwide, thereby increasing the threat itself. Instead, Dr. Fouchier published what one might call a bioterrorism cookbook, complete with a cartoon showing how you can cause a pandemic: image of the cartoon and playbook to breed an outbreak worthy pandemic ( they created avain flu to kill ferrets more on this to follow) Many scientists were outraged at the dangerous exhibitionism of Dr. Fouchier and his team of researchers at Erasmus University. Are citations and grants and fame really worth the risk of causing a pandemic and killing millions of people? Most members of the public were not aware of the rhetorical scientific warzone caused by Fouchier’s actions. The bitter debates over risky research that could cause a pandemic happened outside the public eye. Yet, in order to understand the history of the Covid-19 pandemic, a pandemic most likely caused by risky research, it’s important to learn the history of scientists’ disagreements over gain-of-function research. The debate was so acrimonious, the bitter echoes can still be heard in the halls of the academy. The dividing ethical line that split the field in twain is still there, a 2014 chasm of unreconciled disagreement that splits the fragments of the community and seems to determine their views on 2023 Covid origins. On one side, there were scientists with very good reasons to be concerned that such risk-taking, with no tangible benefits, could cause a pandemic that kills millions of people. On the other side, there were researchers who received fame and funding for their scientific stunts enhancing potentially pandemic pathogens, researchers who claimed that this risky work could potentially lead to insights even if it hasn’t yet, and there were funders who were able to increase the size of their portfolios by pointing to the threats conjured into existence by the scientific minds they funded. The more fear scientists could inspire in the hearts of managers by publishing thoughts which threaten global health, the more funding they could request to “mitigate” the threats of ‘bad actors’ doing exactly what they did. [link to brownstone.org (secure)] this is a very very long article and a deep rabbit hole but this was posted by me a long time ago and this article ties the one below to the beginning of GAIN OF FUNCTION and how avain flu came to be and how to make a diesease evolve faster, hell even create one !!! Thread: H5N1 BIRD FLU WAS CREATED BY DUTCH RESEARCHERS TO KILL FERRETS in 2012; There is, of course, irony that the US biodefense research led by Fauci started after the anthrax attacks, as the anthrax attacks were carried out by a scientist with a position making it easy for them to acquire anthrax. What could happen if Dr. Fouchier had a bout of cynical depression and decided to tip a vial out of spite? Opposition to gain-of-function research of concern recruited many diverse scientists from many diverse fields of study, all of whom could do the obvious arithmetic to see risks » benefits. The lack of benefits needs to be emphasized. There are no countermeasures or vaccines developed by enhancing potentially pandemic pathogens. THAT WE ARE BEING TOLD OF. if you invent you know how to cure? While there were questions about whether the H5N1 influenza strain that Fouchier bred could become transmissible in mammals, finding that it could become transmissible when forced into a scientists’ breeding regime did not answer the question of whether it would become transmissible in mammals in its natural setting. Whichever strain of influenza starts circulating in humans, whether from swine, birds, or other animals, the virus will be countered by broad-spectrum countermeasures like nucleoside analogs or protease inhibitors that we can improve upon without enhancing pathogens, and we can prevent infections and/or reduce severity with vaccines targeting the same-old H and N antigens we know our immune system recognizes to fend off the flu. Fouchier created something not found in nature; something that took him less than a month to breed has not arisen despite avian influenza circulating for decades, infecting many chicken farms, mink farms, and more, all without actually causing the pandemic pathogen Fouchier made. The risks, meanwhile, are nearly infinite. The avian influenza Dr. Fouchier started with had a 50% infection fatality rate, over 100x as severe as SARS-CoV-2. Fouchier did not know what would happen with the infection fatality rate at the end of his experiment, only that his breeding program would increase transmissibility in mammals. If a virus like that escaped the lab, it could kill 30% of humanity from infections alone. Such a virus could overwhelm healthcare systems, and as people struggled to breathe and their family members died without being able to seek care, our medical system could shut down, all our economic systems would suffer catastrophic failures from absenteeism, triggering an economic catastrophe affecting the distribution and humans’ ability to acquire food, energy, and other critical supplies. same link as above part 3 same link as op and still not 50 % Instead, in June 2014 a group of scientists led by the University of Wisconsin, Madison’s Yoshihiro Kawaoka created a virus like the 1918 Spanish Influenza virus in the lab. The 1918 virus killed about as many people as WWII. At this fork in the road, researchers saw a signpost pointing towards “1918 Spanish Influenza” – why on Earth would someone take any path in research that leads towards those horrors? Why are these pathogens being created in our universities? The researchers claimed an avian influenza virus circulating in birds was similar to the 1918 Spanish flu, so they did the influenza virus a favor, made it even more similar to this extinct influenza strain that killed 50 million people, and asked “does that make it worse?” I know there are not any dumb questions, but if there were, then this is would be a dumb question. Obviously, if you have one pathogen that was extremely bad, take other pathogens and make them more like the extremely-bad pathogen, that should be expected to make the not-so-bad pathogen worse. Not surprisingly, the 1918-like avian influenza had intermediate transmissibility, and giving these avian influenza viruses parts of the 1918 influenza increased the severity of illness in mice infected with these unnatural chimeric viruses. Kawaoka published his paper in June of 2014. Like Fouchier’s stunt, Kawaoka’s exceedingly risky work sparked outrage among scientists observing this work. Making a potentially pandemic pathogen more like a pandemic pathogen had the obvious consequence of making the potentially-pandemic pathogen worse. No countermeasures were developed, no vaccines were developed. Nothing of industrial value was made, but rather there were academic accolades for Kawaoka, publications, citations, and grants, and perhaps this work piqued the academic interests of others. The net risk incurred by humanity shot up during the period of time Kawaoka tasked his grad students and post-docs with handling these unnatural pathogens. In a parallel universe, whether from an accident or a disgruntled student who failed their qualification exams, we could have experienced a surge of influenza-like illness in Madison, Wisconsin in 2014 prior to a pandemic that resulted in historic loss of life. Thankfully, we didn’t. Nor did we learn the lessons of 2011 and 2014. Why not? In July of 2014, a group of scientists deeply concerned by Kawaoka’s experiment spoke up. The Cambridge Working Group brought together many scientists from many institutions and many fields of research who signed a consensus statement discouraging the enhancement of potentially pandemic pathogens. The Cambridge Working Group pointed to incidents involving smallpox, anthrax, and bird flu in even the top US laboratories as evidence that the risks of this research could never be reduced even in the most secure environments, and the consequences of a single mistake could be truly catastrophic. In their words, they petition: Experiments involving the creation of potential pandemic pathogens should be curtailed until there has been a quantitative, objective and credible assessment of the risks, potential benefits, and opportunities for risk mitigation, as well as comparison against safer experimental approaches. A modern version of the Asilomar process, which engaged scientists in proposing rules to manage research on recombinant DNA, could be a starting point to identify the best approaches to achieve the global public health goals of defeating pandemic disease and assuring the highest level of safety. Whenever possible, safer approaches should be pursued in preference to any approach that risks an accidental pandemic. Shots fired. Immediately afterwards, a group sprung up to oppose the Cambridge Working Group. This group called themselves “Scientists For Science.” As the name suggests, they were effectively the “boys will be boys” of science calling to let scientists do science. Scientists For Science claimed, without evidence, that they were confident risky research could be conducted safely, that such work is essential for understanding microbial pathogenesis, prevention, and treatment, yet they provide no justification for those claims, no counter to the empirical evidence that such research has led to accidents and no concrete countermeasures or preventions. They claim the benefits are unanticipated and accrue over time – in other words, they admit they can’t anticipate the benefits of such work, and they just need more time to demonstrate these nonexistent, unanticipated benefits. It was for academic interest and unanticipated benefits that they wished to resume work that endangered humanity. It’s worth reading the language of Scientists For Science closely, as it reveals the rhetorical origins of language that became familiar – and anathema – to the majority of the public during the Covid-19 pandemic. Not only did Covid-19 public health policy mirror Scientists For Science’s unusual cost-benefit analysis where benefits were assumed and costs ignored, but it also centered the careers and desires of academic microbiologists who built their careers doing dangerous work at the expense of the broader public. Scientists For Science argue: If we expect to continue to improve our understanding of how microorganisms cause disease we cannot avoid working with potentially dangerous pathogens. In recognition of this need, significant resources have been invested globally to build and operate BSL-3 and BSL-4 facilities, and to mitigate risk in a variety of ways, involving regulatory requirements, facility engineering and training. Ensuring that these facilities operate safely and are staffed effectively so that risk is minimized is our most important line of defense, as opposed to limiting the types of experiments that are done. |
Anonymous Coward User ID: 86896518 United States 02/29/2024 12:03 PM Report Abusive Post Report Copyright Violation | Time Traveler or Insane Psychic Calls Death of Queen on Exact Day 7 Months Ago Quoting: Anonymous Coward 81371545 Quoting: Anonymous Coward 83861127 https://twitter.com/_/status/1138545686100815873 google translate Decipher: 11.06.2019 #US sent a planeload of biological weapons to China. Pandemics may soon begin in China. Let them not forget that if there is a Turk on earth, there is hope. |
Anonymous Coward User ID: 86899722 Russia 03/01/2024 10:03 AM Report Abusive Post Report Copyright Violation | update Quoting: FHL(C) Thank you S-man tThis video below is so good and defines the problem with the mRNA platform (and current shots, too) SO WELL that it literally blows my mind. I think it's so good, you should consider putting it in the OP of this thread? The first bit is technical, but by 59m-69m, they are taking questions and highlighting ALL the problems and why mRNA is flawed... 1h09m: Dr Paul Marik: "I think it's going to be 10-20 years before we actually realise the full extent of this genetic therapy" Thread: Bombshell Study Reveals the Jabbed Are 5X More Contagious Than the Unjabbed 10 Days After Covid Infection [link to godlike.com (secure)] |
Anonymous Coward User ID: 86907666 Canada 03/03/2024 10:49 PM Report Abusive Post Report Copyright Violation | |
Anonymous Coward User ID: 86913083 United States 03/05/2024 03:39 PM Report Abusive Post Report Copyright Violation | Now The Vaxx Thread: CDC Director - “We need to see everyone get an updated flu shot and an updated Covid vaccine” |
Anonymous Coward User ID: 45438790 United States 03/06/2024 04:27 PM Report Abusive Post Report Copyright Violation | |
Anonymous Coward User ID: 85594168 United States 03/06/2024 04:33 PM Report Abusive Post Report Copyright Violation | |
Anonymous Coward User ID: 86648746 United States 03/07/2024 10:25 PM Report Abusive Post Report Copyright Violation | Excerpt: Quoting: Happy in Nature "I want to try and give some hope but I don’t know how well this will work but it is worth trying!!! After learning Australian Scientist had discovered how to destroy the “natural” covid-19 protein spike using pineapple enzyme (Bromelain), I wondered if it would help a double “Vaccinated” person – vaccinated is in inverted commas because legally these jabs do not meet the definition of a vaccine. I know an elderly person who is a close friend of mine who ended up Magnetic after these shots. I talked her into taking the Pineapple enzyme as I seen what the Australian Scientist claimed to have discovered and thought logically it may work with the “Vaccine” as the spike protein was programmed to use our bodies to produce the spike protein to help produce a response via our immune system. After taking this for just over a month she is now to my surprise no longer magnetic as I retested her!" "I found two peer-reviewed studies that have been published since COVID-19 started, where it was being tested as an early treatment for COVID-19. One study looked at just bromelain, and another one (the one in Australia) looked at a compound of bromelain with Acetylcysteine (BromAc), which has been previously studied in cancer treatment. The first study was carried out by researchers at the University of Nebraska Medical Center, and a “preprint” copy of the study, meaning that it had not yet been peer-reviewed, was published in bioRxiv in September of 2020. After it was peer-reviewed, it was published in the journal Clinical and Translational Medicine in February of 2021 with the title: Bromelain inhibits SARS‐CoV‐2 infection via targeting ACE‐2, TMPRSS2, and spike protein. The study was funded, at least in part, by the HIH and the FDA assisted as well, according to the “Acknowledgements.” And yet, this study never made it into my newsfeeds, either in the corporate media or the alternative media." [link to healthimpactnews.com (secure)] Thread: Is Pineapple Enzyme Bromelain a Remedy for COVID-19 Vaccine Injuries? |
Anonymous Coward User ID: 86386693 United States 03/09/2024 09:08 PM Report Abusive Post Report Copyright Violation | Trump probably failed in the tariffs and trade war with the chicoms. Quoting: Anonymous Coward 45438790 Now he can begin the mRNA shit in Chynah! If he wins 2024… Thread: NEW: Trump is pushing mRNA vax again. “The Vaccines that saved us from COVID are now being used to help beat Cancer” |
Anonymous Coward User ID: 86250705 United States 03/12/2024 05:31 PM Report Abusive Post Report Copyright Violation | |
Anonymous Coward User ID: 86946259 United States 03/13/2024 04:42 PM Report Abusive Post Report Copyright Violation | When Omicron showed up Covid won and you all lost and now it is slowly annihilating you all because psychologically you think it is not a threat which weakens your immune system. Quoting: OneThreeOne Heart problems along with other diseases increase following Covid infection because Covid is vascular and travels throughout the body. You all following/promoting the death jab narrative are obscuring the true problem. My parents are healthy, they eat right, don't even own a microwave.. High doses of Vitamin C daily etc. No jabs or tests. That Omnicron hit both of them. They were in bed for a month and say they haven't felt the same since. My moms legs are always cold now and cramp up. She has a hard time breathing when she wakes up and never has smoked cigs. And her heart is only working %50 now. Yep. I've had it three times, the last being in September of 2023. I didn't feel right after the first infection in December of 2019 and I just assumed for three years that COVID damaged my lungs. Started having wicked bouts of arthritis last fall into winter, hands and knees killing me. Heart palpitations started in January and unless I'm busting my ass working out for over an hour a day, they come back. Of course the flip side is, I'm worried if I bust my ass and work out, my heart will fail. Too many people thought this virus was fake to get people to take the vaccine, not understanding the virus itself damages your heart. It is standard flu. If it was as bad as propagated, TPTB would not have had to fudge the stats and claim anything 1and everything as "Covid" for 18 months. Besides, they wouldn't wouldn't release a bioweapon that requires an antidote to mitigate collateral damage when they can just frightened the public with non-stop fear mongering to inject themselves with a poison. They can be selective in who gets what. They did all kinds of precovid psychological tests to know. Look how many fell for the TP hoax. When that happened, they knew they could brainwash the public but needed a novel scary name to convince all those who quite getting flu shots to line up. They did. It worked. Masks, testing, antisocial distancing protocols all worked as placebo reinforcement. Thread: Heart failure in Navy Pilots up 973% (Page 4) |
Anonymous Coward User ID: 86946366 Canada 03/15/2024 10:43 PM Report Abusive Post Report Copyright Violation | What happened to RILEY STRAIN? He disappeared on March 8th in Nashville after being kicked out of Luke Bryan's 32 Bridge Bar for being overserved. Quoting: Mr_Incredible He came from the University of Missouri to Nashville for the visit, and he was on his way back to the hotel where he was staying with friends, but never made it back to the hotel. [link to www.youtube.com (secure)] [link to www.tmz.com (secure)] Where is Riley Strain? [imgur] [link to imgur.com (secure)] [link to imgur.com (secure)] Here are some pics of Luke Bryan's 32 Bridge Bar: [imgur] [link to imgur.com (secure)] [link to imgur.com (secure)] [imgur] [link to imgur.com (secure)] [link to imgur.com (secure)] If you look at this thing with the name of the bar that Riley Strain disappeared from, it's interesting... Riley disappeared from the 32 Bridge Bar. Take a look at the number 32. We all know what 33rd degree freemasonry, but what about the 32nd degree, which comes right before the 33rd degree... Also, how about Riley's last name (STRAIN). We all know what the word "STRAIN" is a reference to (VIRUS). Also, here's an important point... **RILEY STRAIN disappeared on 3/8 **RILEY STRAIN was at the LUKE BRYAN 32 Bridge Bar before he disappeared Why does this matter? I'll explain... **MH370 disappeared on 3/8 (in the year 2014) **MH17 was shot down on 7/17 (in the year 2014) **LUKE BRYAN was born on 7/17 (RILEY STRAIN Disappeared from LUKE BRYAN's bar) **On July 13th, 2014, 4 days before MH17 was shot down, the TV Series "THE STRAIN" premiered...and Riley's last name is "STRAIN": [link to www.youtube.com (secure)] So, the Malaysian planes from 2014 (MH370 and MH17) are connected to this RILEY STRAIN ritual. The RILEY STRAIN ritual is really about the Coronavirus (because the word "STRAIN" is a reference to the various strains of the CORONAVIRUS...that's the key clue). This is a Coronavirus ritual...that's why you have two people in a short period of time in the news that have that same name, RILEY (LAKEN RILEY, who was murdered, and RILEY STRAIN, who is probably dead). Remember, the day before RILEY STRAIN disappeared, on 3/7, Joe Biden gave his State of the Union Speech where Marjorie Taylor Greene shouted out the name "LAKEN RILEY." Then, the next day, on 3/8, RILEY STRAIN disappeared: [link to www.youtube.com (secure)] 32nd Degree Freemasonry: [link to www.youtube.com (secure)] 33rd Degree Freemasonry: [link to www.youtube.com (secure)] Thread: RILEY STRAIN (Body Found on 3/22): Disappeared on 3/8 in Nashville, kicked out of Luke Bryan's 32 Bridge Bar (AIDS/CORONAVIRUS RITUAL) |
Anonymous Coward User ID: 86954271 Australia 03/16/2024 01:30 PM Report Abusive Post Report Copyright Violation | Thread: NEVER FORGET - John Campbell Insisted you Get the Covid Vaccine Not So Long Ago [link to www.godlikeproductions.com] PROBLEM REACTION SOLUTION RETRACTION? |
Anonymous Coward User ID: 86955799 United Kingdom 03/18/2024 05:44 PM Report Abusive Post Report Copyright Violation | Another made in Chynah scare? Quoting: Anonymous Coward 86960550 Quoting: Anonymous Coward 86955799 |
Anonymous Coward User ID: 86963186 United States 03/19/2024 04:52 PM Report Abusive Post Report Copyright Violation | BALLS N ARROW is an Cee Eye Aye Asset Thread: JUST IN -- Brazil’s ex-President Jair Bolsonaro indicted for allegedly lying about COVID vax status in government database |
Anonymous Coward User ID: 86706128 Germany 03/21/2024 04:55 AM Report Abusive Post Report Copyright Violation | Situation Update, 9/21/22 - Plum Island tick-based bioweapons: USDA and DoD secret research... [link to rumble.com (secure)] |
Anonymous Coward User ID: 86408654 United States 03/22/2024 07:35 PM Report Abusive Post Report Copyright Violation | |
Anonymous Coward User ID: 86981735 Australia 03/25/2024 07:23 PM Report Abusive Post Report Copyright Violation | |
Anonymous Coward User ID: 86621527 United States 03/27/2024 02:29 AM Report Abusive Post Report Copyright Violation | |
Anonymous Coward User ID: 45438790 United States 03/27/2024 03:43 PM Report Abusive Post Report Copyright Violation | I've seen threads on here that mentioned venom! this is a must watch! [link to www.bitchute.com (secure)] Thread: ABSOLUTE BOMBSHELL DOCUMENTARY - COVENOM-19 |
Anonymous Coward User ID: 86989601 United States 03/27/2024 04:12 PM Report Abusive Post Report Copyright Violation | |
Anonymous Coward User ID: 76475573 United States 03/28/2024 07:10 PM Report Abusive Post Report Copyright Violation | The Bio Terror Bible Exposing The Coming Bio Terror Pandemic.pdf The document summarizes the claims which alleges that the US government is planning and preparing for a staged bio-terror attack and pandemic that will kill millions. https://twitter.com/_/status/1773396716236214695 |
Anonymous Coward User ID: 86880178 Netherlands 03/28/2024 09:30 PM Report Abusive Post Report Copyright Violation | |
Anonymous Coward User ID: 86997821 Singapore 03/29/2024 01:15 PM Report Abusive Post Report Copyright Violation | What disease was the CDC shipping to Sri Lanka? Quoting: Anonymous Coward 86847205 DiseaseX in 55 gallon drums? CDC Hazmat Containers on Board the Dali! Could the Baltimore Bridge Crash Have been an Attack? an elite Coast Guard team is inspecting 13 Centers for Disease Control containers that were on board labeled with the warning “Hazardous Materials.” This raises all kinds of questions. Why is the CDC sending Hazmat containers to Sri Lanka? That is where the Dali was headed when it left the Port of Baltimore before crashing into the Scott Key Francis Bridge. [link to www.thegatewaypundit.com (secure)] |
Prince Rupert
User ID: 40583271 Canada 03/29/2024 03:47 PM Report Abusive Post Report Copyright Violation | DARK AND SINISTER OPENING CEREMONY OF THE 2012 LONDON OLYMPICS USED PREDICTIVE PROGRAMMING TO SHOW US THE COMING COVID-19 PLANNEDEMIC Quoting: Anonymous Coward 78957263 I recall seeing snippets of the 2012 London Olympics opening ceremony live on television, and remember turning it off in disgust it was so dark, evil and sinister. Naturally it involved children being tortured by demons because the global elites are all pedophiles. But taking a fresh look at those ceremonies in light of the current COVID-19 hysteria, and let me tell you, it is a both eye opener, to say the least. Today we bring you a predictive programming video that will not only shock you, it will also make you mad as you realize that everything that is happening has already been mapped out and planned out for quite some time. [link to www.nowtheendbegins.com (secure)] COVID19 - CIA/MI6/NATO BLACK OPS Many of our military athletes sick from it too well before the Wuhan outbreak |
Anonymous Coward User ID: 11877986 New Zealand 03/30/2024 07:28 PM Report Abusive Post Report Copyright Violation | |
Anonymous Coward User ID: 87004655 Russia 03/31/2024 01:16 PM Report Abusive Post Report Copyright Violation | Amazing! Shocking! Quoting: Anonymous Coward 86133287 We Are Always Ahead Of Time! [link to godlike.com (secure)] "Moderna had made 100,000 doses in 2019, for the whole year. And I remember walking, after Davos, into the office of my head of manufacturing and I said "how will we make a billion doses next year?", and he looked at me a bit funny and said "what?". I said "yeah, we need to make a billion doses next year, there's going to be a pandemic." Quoting: Jwnlwplus4 https://twitter.com/_/status/1685652105590099969 |
Anonymous Coward User ID: 86688293 Australia 03/31/2024 04:46 PM Report Abusive Post Report Copyright Violation | Unfortunately, a new virus is going around that is turning what is normally a week-long nuisance into a month-long nightmare – and speculation abounds regarding its origin. Quoting: okydoky [link to www.naturalnews.com (secure)] Thread: “Mystery virus” spreading like wildfire across U.S. population, putting people in bed for a MONTH… is this a depopulation bioweapon COVID 19 version 1.0 They tweaked it and sent it to Wuhan via the US World Military Games athletes ‘ medic team! |