DO NOT FORGET THE US FOISTED THIS SARS COV-2 ON THE WORLD SETTING OFF THIS COVID-19 PANDEMIC

https://twitter.com/_/status/1587078926907621376

[link to www.bitchute.com (secure)]

https://twitter.com/_/status/1587078926907621376

[link to www.bitchute.com (secure)]

As far as I know NOBODY ANYWHERE has done this matching.
It's new. It could be profound. It draws a link between a 2006 publication and what's supposed to be circulating now.

The match itself is 26 consecutive bases long.
The chance of that being random is cosmically low: 4-to-the-power-26 (4x4x4xx4x4x4x4x4x4x4x4x4x...)

If it is not a known CoV sequence, it could be a smoking gun.


Details:
========
I am matching between a (2006) paper [link to www.researchgate.net (secure)] naming an insert from a virus called "SARS-CoV-2", Supplementary Material [link to academic.oup.com (secure)] file: "clinchem.2006.069971-1.doc"

and

The published genome (2020) of SARS-Cov-2 (Wuhan-Hu-1) from Genbank: [link to www.ncbi.nlm.nih.gov (secure)]

I ran some basic analysis on this, systematically checking for long matches.
The longest I found was TWENTY SIX nucleotides in a row!

So, here is the 2006 sequence they call SARS-CoV-2 insert, 190 nucleotides long:
atgaattaccaagtcaatggttaccctaatatgtttatcacccgcgaagaagctat​
tcgtcacgttcgtgcgtggattggctttgatgtagagggctgtcatgcaactagagat
gctgtgggtactaacctacctctccagctaggattttctacaggtgttaacttagtagc
tgtaccgactggttatg

I have highlighted the longest match I found (atgtttatcacccgcgaagaagctat).

That sequence is found in the 2020 Genbank submission for SARS-CoV-2 (Wuhan-Hu-1) here: [link to www.ncbi.nlm.nih.gov (secure)]
at position 18253:
(snip)
18241 ggttacccta acatgtttat cacccgcgaa gaagctataa gacatgtacg tgcatggatt
(snip)


---------------------------

Aside: Quote from 2006 paper:
"we tried to directly package a 1200-nucleotide–long foreign RNA sequence containing gene fragments of hepatitis C virus (HCV), HIV-1, severe acute respiratory syndrome coronavirus 1 (SARS-CoV1), and SARS-CoV2 into the original armored RNA production vector..."

---------------------------

Now, if anyone knows whether atgtttatcacccgcgaagaagctat is a common sequence for CoV's, please let me know!!??

I just found 26-nucleotide match between a 2006 paper naming 'SARS-CoV-2" and the current 2019 version.




Thread: I just found 26-nucleotide match between a 2006 paper naming 'SARS-CoV-2" and the current 2019 version.

This is from the covid thread, but I think it needs a wider group to see it!




There are known inserts from HIV-1 in the SARS2 spike, as well. They knew all of this, yet continue to gaslight us.

How different the response of people might have been to vaccination with a bio-lab enginneered spike (possible bioweapon) over something they thought came from a bat/pangolin party? Might they have looked more closely at the toxicity of the spike itself?





EDIT: Even if you don't believe viruses exist, you can't deny the existence of the Moderna Patent from 2016, AND the spike programmed in the 'vaccines' matching that patent.
It's fishy.

The New York Times (not exactly a right wing publication) posted an article right before Covid in late 2019 that said Gates went with Epstein many times, this was after Epstein was "suicided" and was well known to the public. This was a threat, do as your told. We got the goods on you, do as your told or you're going down Gates. We have it on video, do as your told.

[imgur] [link to i.imgur.com (secure)]

They put it behind a paywall but it's very real.

[link to www.nytimes.com (secure)]

Prepare accordingly

Great video, thanks...
Source:
[link to www.bitchute.com (secure)]

!!! REALLY !!!??? - EXTREMELY INTERESTING SPEECH FROM ANTHONY PATCH 2013 - 2014 !!!
This man Anthony Patch said in 2013 - 2014 exactly what is happening Today. What else do you want to see that this [email protected] is POISON is DANGEROUS? Do NOT make this Poison !!!
If even after this Video you will not understand that the World Elites wants you dead, then I am sorry but nature is following its course...
This video can barely be found on the internet and MSM says it's fake because he didn't say something like that !!!
Well well well is REAL and is HERE NOW !!!

[link to rumble.com (secure)]

Lest you forget

DARPA INSIDE GOVERNMENT DOCUMENT PROVES THE U.S. WAS BEHIND THE COVID VIRUS

[link to www.bitchute.com (secure)]

In 2017, members of John's Hopkins wrote the 70+ page hypothetical fiction of a "SARS" type pandemic....

"SPARS" (just google it)

The miracle vaccine was called "Covavax".

Everything fits in terms of the need for government overreach, fast vaccine rollout, vaccine passports, media campaigns to be vaxxed...

AND, there are differences between their fiction and the reality of the Covid Pandemic:

1. In their hubris, the writers state that people clamour for the vax, and there are shortages and lines to get it.

2. The major groups rejecting the vax are not redneck anti-vaxxers, but Muslims and other religious observers.

BUT.... AND THIS IS A BIG "BUT"....

The outcome???

The Vax in their fiction was "rolled out too fast", unsafe. Causes major death and injuries.... sound familiar?

A BACKLASH rises in the public by way of mistrust of the governments worldwide...sound familiar?

And IT'S THIS.... THE BACKLASH...THE BACKLASH FORCES WORLWIDE LOCKDOWNS AND MEASURES BY THE GOVERNMENTS TO TO ASSURE NO UPRISINGS.CHECKPOINTS, MILITARY, ETC.

IN OUR FACES.

I say in our faces, because those few who wrote this have twitter accts. Their tweets echo the writings from the SPARS pandemic fictional scenario they wrote about.

Example, they mention in the paper that there is a need for mass MSM vaccine campaigns (remember, this is 2017...), then, in 2020 - they are tweeting as to how their needs to be a strong MSM vax campaign.

Either way, MOST here with a brain are excited that the vax is being exposed, rightfully so!

But to what end?

According to the writers of "SPARS" - that end is a SUPER pissed public, and the answer is communist style lockdowns and governing to quell civil unrest.

Can't win with these asshats in power, so it wouldn't suprise if this is what comes next.

Just my 2 cents.

Dr Jordan B Peterson and Matt Ridley go in depth to explore the Covid 19 outbreak, scrutinizing the lack of criticism, the inherent red flags widely accepted as benign, the possible motive for a multi-government cover up, and ultimately the demise of the scientific enlightenment as it bends to a more fearsome pandemic: totalitarianism.

Made in China by US Operatives.

OUT SUN TZUed the Sun Tzus.

This is a bit interesting.
[link to ieeexplore.ieee.org (secure)]

If It’s That Bad That We Are Being Conditioned To Believe Arrests Are Imminent Again.....Where Trump Has To Actually Warn Us About The Ramifications Of Voter Fraud By Advising Us To Learn To Speak Chinese If Trump’s Former Party Manages To Steal The Election....Yet Won’t Acknowledge That The DNC Has Been Infiltrated By The Chinese To The Extent That It’s An Insurgency.....What Other Contingency Does The Citizenry Have To Combat Such Tyranny?

No talk of violence

I do not want a civil war

I think all of GLP would agree

That orange puppet needs to start acting like he means what he says

This Administration doesn’t get to have it both ways when his former party has declared war on us by any means necessary to destroy our very way of life because they know we don’t want a civil war

It’s as obvious as ever that Russia is allied with China which is in bed with the DNC, from Fauci and Wuhan to Hunter Biden’s BILLION DOLLAR investment paycheck from the CCP, so naturally any invasion would be preceded by mass civil unrest to try and prep the objective, which would be swiftly put down in the suburbs and rural areas as we have already seen hence why GOVERNORS and Trump’s DOJ are using red flag laws against conservatives disproportionately

I can prove without a shadow of a doubt that LAW ENFORCEMENT in BLUE STATES and COUNTIES are just as corrupt as the politicians they are being paid to protect while the thousands of SANCTUARY CITIES in those jurisdictions are overflowing with MILLIONS of ARMED FELONS and ARMED ILLEGAL ALIENS that were imported to steal elections by companies using that slave labor to buy lobbyists who then launder those record profits through SUPER PACS to buy politicians

First you mock Biden and the Chinese saying coronavirus is the longest lasting product China ever made while saying BLM. and ANTIFA are retarded pussies that can’t operate a can opener

Then in the same breath admit that China has infiltrated the DNC to the point of insurgency using BLM to run interference for Islam to take over the White House yet can’t see Trump is allowing that to happen right now

You don’t get to have it both ways otherwise Hunter Biden would already be in prison and Joe Biden would already be in Hell with the Clintons but please change the subject so you don’t have to explain why the Trump Foundation is closed but not the Clinton Foundation

Biden is a joke and more proof this election is as fake as that impeachment was but please keep playing the same game saying this election is dire to the future of the Republic yet Trump’s own actions don’t match his rhetoric in the same exact way because if this was the end of humanity like Trump’s former party would have you believe, than the DNC SUPERDELEGATES wouldn’t have anointed Biden to be a patsy with proven corruption on par with TREASON AND still not one elected politician from DC has been drained from the swamp in handcuffs

This is just more bullshit to pacify and appease so no one questions why Trump hasn’t taken the leash off of 65 million highly trained Americans if his former party really is his sworn enemy warning us to learn Chinese instead of telling the citizenry of this Constitutional Republic to learn how to shoot!

America would not be more vulnerable if there was a civil war because half of America would be pulling security 24/7 at the ready with gear on cocked and locked and ready to rock

A rifle barrel behind every single blade of grass ready to MAGA legally

Civil unrest would be inevitable

By the enemy invading!

No talk of violence

Thread: Trump: "If Biden wins, you'll have to learn to speak Chinese"

Thread: Civil war will be followed by invasion of America

Shocking that none of you wants to even touch any of this

Just like no one wants to ask why Senator Feinstein is not in prison

If you or I tried to say our Chinese handler was our “DRIVER”, we still would’ve been arrested quicker than you can say Ruby Ridge or Waco

You people need to start asking why Trump won’t even tweet about it

Just like he didn’t tweet about the IRS Tea Party coverup

Now replace the word Chinese handler with Russian handler and think about how quick we would’ve had FEDERAL AGENTS kicking in our door in the middle of the night but keep swallowing GLP

Trump’s former party has declared war on our very way of life while Trump whines like a bitch on Twitter to steer the conversation away from the obvious

That orange puppet is scripting our entire reality still

Thread: Exposing Harvard's Chinese Agent And Nanoscientist Charles Lieber's "Virus Transmitters"

Thread: Dr. Charles Lieber Coronavirus 5G his own study 2015

Thread: DR. CHARLES LIEBER- BUSTED BY SWORN TESTIMONY- CREATOR OF COVID19

War is already here and has been

Trump doesn’t have the balls to admit it

Democrat Governors declared war long ago

Only difference is conservatives don’t fight back

Police have been red flagging conservatives for years

These RAINBOW GESTAPO with BADGES violate their oath with every unconstitutional no-knock military style SWAT raid that has resulted in hundreds of deaths because of citizens just being in the vicinity of a firearm handing out death sentences without a trial

Every BLUE COUNTY and STATE has its own standing Army, from the local MUNICIPALITIES to the COUNTY SHERIFFS DEPARTMENT, all with DIRECT ACTION ELEMENTS known as SWAT with the same capabilities, logistics, and air support, including QUICK REACTION FORCE DEPLOYABILITY (SRT) as swiftly lethal as any MILITARY JSOC TEAM, and that’s not even taking into account STATE POLICE and NATIONAL GUARD and RESERVE ASSETS

The battle lines have already been drawn just like the President’s former party has declared war on STRAIGHT WHITE CHRISTIAN CONSERVATIVES whether the President chooses to acknowledge it or not doesn’t make it any less so

Trump was elected to combat this unconstitutional tyranny

China has infiltrated every facet of the “Democrat Party“

An obvious insurgency from Hollywood to all NEWS

By using any means necessary to radicalize us

While Trump whines like a bitch on Twitter

Official government documents show that messenger RNA (mRNA) vaccines were in development long before Donald “father of the vaccine” Trump officially launched Operation Warp Speed on May 15, 2020 – and his daughter Ivanka admitted this in a tweet from later in the year that many seem to have missed.

A public-private partnership involving both the government and the private sector started funneling resources into the development of covid injections on Jan. 13, 2020, Ivanka Trump tweeted on Nov. 16, 2020. She wrote:

“Fact Check: This Moderna / NIH vaccine is literally the one that President @realDonaldTrump partnered with Moderna to create on January 13, 2020 … I repeat January 13th, 2020.

Just be happy. This is great news for America and for the world!”

That “great news” ultimately led to tens of millions of vaccine injuries and deaths – and counting – all around the world. But the real kicker here is what Ivanka Trump admitted: covid vaccines were already in development before the first confirmed case of covid was even announced on Jan. 20, 2020.

[link to www.naturalnews.com (secure)]


Chynah Chynuh Chaina Chyna Chynise

Trump attended davos wef 2018 and we got the vaxx few years after that
Entire Trump family works for WEF.

No summary, header speaks for itself. listen or dont!



[link to www.bitchute.com (secure)]